ID: 979565800_979565814

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 979565800 979565814
Species Human (GRCh38) Human (GRCh38)
Location 4:122152725-122152747 4:122152770-122152792
Sequence CCATCCTTACCTACAGCCCTGGC GTCAGTGGCAAAGTCTGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 286} {0: 1, 1: 0, 2: 6, 3: 29, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!