ID: 979568101_979568113

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 979568101 979568113
Species Human (GRCh38) Human (GRCh38)
Location 4:122179875-122179897 4:122179903-122179925
Sequence CCTCCCTGCCCCCCACATACAGA GTACCATTCCAGATCAATGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 88, 4: 800} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!