ID: 979662932_979662944

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 979662932 979662944
Species Human (GRCh38) Human (GRCh38)
Location 4:123279241-123279263 4:123279291-123279313
Sequence CCCCATCTCTACTAAAAATACAA CTGTAATCCCAGCTGAGGCTGGG
Strand - +
Off-target summary No data {0: 3, 1: 11, 2: 26, 3: 87, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!