ID: 979981235_979981239

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 979981235 979981239
Species Human (GRCh38) Human (GRCh38)
Location 4:127257904-127257926 4:127257948-127257970
Sequence CCATAATTCTAAAATTGCTTAAT TCTTAAATGGAGATAATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 505} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!