ID: 980102176_980102180

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 980102176 980102180
Species Human (GRCh38) Human (GRCh38)
Location 4:128552702-128552724 4:128552730-128552752
Sequence CCTGCTTGGGCCCACAGGTGCCT GATCGCATCCTTATGCCTAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 233} {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!