ID: 980202467_980202472

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 980202467 980202472
Species Human (GRCh38) Human (GRCh38)
Location 4:129674311-129674333 4:129674346-129674368
Sequence CCAGATTTGTTCCTGGAATATGT CGGGCATGCTGACTTCAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!