ID: 980871966_980871972

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 980871966 980871972
Species Human (GRCh38) Human (GRCh38)
Location 4:138622093-138622115 4:138622139-138622161
Sequence CCTGCTGGATCTGGAGGGGTGGA TGGCAAACAGCAGTGGTGCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!