ID: 980913865_980913871

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 980913865 980913871
Species Human (GRCh38) Human (GRCh38)
Location 4:139016406-139016428 4:139016454-139016476
Sequence CCCGCTTGACCCTTAGAGGCCAT CGTTAAATTTCCCCCTTCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 97} {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!