ID: 980916161_980916165

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 980916161 980916165
Species Human (GRCh38) Human (GRCh38)
Location 4:139035091-139035113 4:139035104-139035126
Sequence CCTCCATCCTTCTGGTCGCTCAG GGTCGCTCAGCTGGAAACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 204} {0: 1, 1: 0, 2: 1, 3: 17, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!