ID: 980958661_980958674

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 980958661 980958674
Species Human (GRCh38) Human (GRCh38)
Location 4:139453748-139453770 4:139453798-139453820
Sequence CCGTGGTACCTCCTTCCTCTCAG GATTGCGCGGCTTCCTCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 43, 4: 325} {0: 1, 1: 1, 2: 0, 3: 4, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!