ID: 980994616_980994621

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 980994616 980994621
Species Human (GRCh38) Human (GRCh38)
Location 4:139768720-139768742 4:139768734-139768756
Sequence CCTGCTGCAGCACCCCATGGTGC CCATGGTGCTGGCTGATGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 583} {0: 1, 1: 0, 2: 3, 3: 12, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!