ID: 980994616_980994626

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 980994616 980994626
Species Human (GRCh38) Human (GRCh38)
Location 4:139768720-139768742 4:139768758-139768780
Sequence CCTGCTGCAGCACCCCATGGTGC GTCTGGGTAGACAGAAATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 583} {0: 1, 1: 0, 2: 1, 3: 25, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!