ID: 981045556_981045560

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 981045556 981045560
Species Human (GRCh38) Human (GRCh38)
Location 4:140261840-140261862 4:140261858-140261880
Sequence CCAGCAAGGAGTTAGAGAATGTG ATGTGTGACCAGGGCTTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 9, 4: 141} {0: 1, 1: 0, 2: 0, 3: 14, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!