ID: 981051252_981051261

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 981051252 981051261
Species Human (GRCh38) Human (GRCh38)
Location 4:140311597-140311619 4:140311630-140311652
Sequence CCCTCTTCCTCCTGGTAAGCCTG GATATCAGCACAGTGGTGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!