ID: 981123390_981123394

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 981123390 981123394
Species Human (GRCh38) Human (GRCh38)
Location 4:141078183-141078205 4:141078202-141078224
Sequence CCAAGAGATGCCTGTACTTAACC AACCATTCCCTCAGTGAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104} {0: 1, 1: 0, 2: 1, 3: 17, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!