ID: 981127570_981127573

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 981127570 981127573
Species Human (GRCh38) Human (GRCh38)
Location 4:141124044-141124066 4:141124062-141124084
Sequence CCCTTCAGCTCCTGCTTTAAGGT AAGGTCCATGAATACCCCGAAGG
Strand - +
Off-target summary {0: 2, 1: 15, 2: 17, 3: 59, 4: 229} {0: 1, 1: 1, 2: 26, 3: 32, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!