ID: 981244408_981244417

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 981244408 981244417
Species Human (GRCh38) Human (GRCh38)
Location 4:142517110-142517132 4:142517143-142517165
Sequence CCTTCCACCCTCTGCATACCAGG AAATTCTACAGCAGTCAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 567} {0: 1, 1: 0, 2: 1, 3: 37, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!