ID: 981392400_981392407

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 981392400 981392407
Species Human (GRCh38) Human (GRCh38)
Location 4:144206670-144206692 4:144206710-144206732
Sequence CCAGCCACAGAGAACAGAACCAG AGTGACTAAACACTCTGTGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!