ID: 981462808_981462813

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 981462808 981462813
Species Human (GRCh38) Human (GRCh38)
Location 4:145031775-145031797 4:145031813-145031835
Sequence CCTGCCATCTTTTGCAAATAACT GACATCTCTTGACTGGGCTTTGG
Strand - +
Off-target summary {0: 2, 1: 12, 2: 206, 3: 213, 4: 315} {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!