ID: 981504306_981504318

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 981504306 981504318
Species Human (GRCh38) Human (GRCh38)
Location 4:145482451-145482473 4:145482486-145482508
Sequence CCGGGCCGAGGCCCGTTCGCGTG ATTGTGTCCCCCGCGCCGGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!