ID: 981509569_981509576

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 981509569 981509576
Species Human (GRCh38) Human (GRCh38)
Location 4:145541093-145541115 4:145541118-145541140
Sequence CCTGTCTACCTCTCTCCCTTCCT TCACCACTAACCTGTATGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 51, 3: 913, 4: 7883} {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!