ID: 981510917_981510924

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 981510917 981510924
Species Human (GRCh38) Human (GRCh38)
Location 4:145557533-145557555 4:145557564-145557586
Sequence CCTTCATTCCTCAAGACCAGCAA GGAATCCATGGATGGACCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 238} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!