ID: 981549992_981550001

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 981549992 981550001
Species Human (GRCh38) Human (GRCh38)
Location 4:145934457-145934479 4:145934501-145934523
Sequence CCCATCTCCAAAGCTAATTCGGT CTAACTGAACAGAAGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67} {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!