ID: 981756655_981756663

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 981756655 981756663
Species Human (GRCh38) Human (GRCh38)
Location 4:148147202-148147224 4:148147240-148147262
Sequence CCTATTTCCCACCTTTCCTCCAT TACCGAAGAATAAGATCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 79, 4: 751} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!