ID: 981782851_981782859

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 981782851 981782859
Species Human (GRCh38) Human (GRCh38)
Location 4:148445458-148445480 4:148445484-148445506
Sequence CCCCTCGCTCTGACGGCGGCTCA GCCCGCGGAGGCGGCTCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 42} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!