ID: 981963610_981963612

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 981963610 981963612
Species Human (GRCh38) Human (GRCh38)
Location 4:150573863-150573885 4:150573878-150573900
Sequence CCTGCTTAGATCTATCTTTTAAC CTTTTAACACAGTAGGAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 185} {0: 1, 1: 0, 2: 0, 3: 13, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!