ID: 981982206_981982209

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 981982206 981982209
Species Human (GRCh38) Human (GRCh38)
Location 4:150807445-150807467 4:150807474-150807496
Sequence CCAATTGTGGTAAAGAAAATCAA TCTGGACACTAAGTCTCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 560} {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!