ID: 982013466_982013471

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 982013466 982013471
Species Human (GRCh38) Human (GRCh38)
Location 4:151129266-151129288 4:151129304-151129326
Sequence CCAGGCACATTAGAGAAAGGTTT CAGCTCTGCCAATTTGGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!