ID: 982026498_982026507

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 982026498 982026507
Species Human (GRCh38) Human (GRCh38)
Location 4:151257631-151257653 4:151257668-151257690
Sequence CCGTGGCTGGGTGCGGTGGCTCA ATGCTTTGGGAGCCTGGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 31, 3: 353, 4: 3799}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!