ID: 982055316_982055319

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 982055316 982055319
Species Human (GRCh38) Human (GRCh38)
Location 4:151543317-151543339 4:151543338-151543360
Sequence CCCTCCAAAACTGTATGCTTAGC GCCCCTCACCACCAGCCCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116} {0: 1, 1: 0, 2: 4, 3: 30, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!