ID: 982145462_982145464

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 982145462 982145464
Species Human (GRCh38) Human (GRCh38)
Location 4:152384446-152384468 4:152384496-152384518
Sequence CCACTTATATAAGGTACTTGGAA GAATCATGGTTGTCTGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 40, 3: 243, 4: 926} {0: 1, 1: 0, 2: 0, 3: 41, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!