ID: 982148713_982148716

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 982148713 982148716
Species Human (GRCh38) Human (GRCh38)
Location 4:152427926-152427948 4:152427950-152427972
Sequence CCTGCAAAAGGTTCAGCAACCAG GGTCCCCAGACCAAATTTTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 10, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!