ID: 982155274_982155277

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 982155274 982155277
Species Human (GRCh38) Human (GRCh38)
Location 4:152514145-152514167 4:152514193-152514215
Sequence CCAGAAAATTTAAATTTAACTAT CTGTCTCAGAAGAAGCTAAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 111, 4: 784} {0: 1, 1: 0, 2: 1, 3: 16, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!