ID: 982256542_982256551

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 982256542 982256551
Species Human (GRCh38) Human (GRCh38)
Location 4:153456766-153456788 4:153456798-153456820
Sequence CCTCCCAAAGTGCTGGGATTACA CACCGCGCCCGGCTTTGCGGCGG
Strand - +
Off-target summary {0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!