ID: 982256545_982256551

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 982256545 982256551
Species Human (GRCh38) Human (GRCh38)
Location 4:153456770-153456792 4:153456798-153456820
Sequence CCAAAGTGCTGGGATTACAGGCG CACCGCGCCCGGCTTTGCGGCGG
Strand - +
Off-target summary {0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!