ID: 982350370_982350380

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 982350370 982350380
Species Human (GRCh38) Human (GRCh38)
Location 4:154408836-154408858 4:154408886-154408908
Sequence CCCAGCAGTCCTCATCACCACTT AACATCTGAGGTTCTCACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 236} {0: 1, 1: 0, 2: 0, 3: 16, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!