ID: 982371892_982371896

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 982371892 982371896
Species Human (GRCh38) Human (GRCh38)
Location 4:154642715-154642737 4:154642741-154642763
Sequence CCTCAATTTATATTGACCCACTC AATTTGCATGTAATTGACATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 29, 3: 151, 4: 508}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!