|
Left Crispr |
Right Crispr |
Crispr ID |
982723262 |
982723271 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:158881188-158881210
|
4:158881225-158881247
|
Sequence |
CCCTCCACGGTCTCCCTCTCCCT |
TCCCTCTCCCTCTCTTTCCACGG |
Strand |
- |
+ |
Off-target summary |
{0: 11, 1: 5, 2: 11, 3: 298, 4: 903} |
{0: 665, 1: 199, 2: 108, 3: 200, 4: 963} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|