ID: 982723262_982723271

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 982723262 982723271
Species Human (GRCh38) Human (GRCh38)
Location 4:158881188-158881210 4:158881225-158881247
Sequence CCCTCCACGGTCTCCCTCTCCCT TCCCTCTCCCTCTCTTTCCACGG
Strand - +
Off-target summary {0: 11, 1: 5, 2: 11, 3: 298, 4: 903} {0: 665, 1: 199, 2: 108, 3: 200, 4: 963}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!