ID: 982953226_982953232

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 982953226 982953232
Species Human (GRCh38) Human (GRCh38)
Location 4:161727592-161727614 4:161727610-161727632
Sequence CCAGTTCTAACCCCTGACCCTAA CCTAACCCTGCATTTTTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 152} {0: 1, 1: 0, 2: 2, 3: 22, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!