ID: 983057996_983057998

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 983057996 983057998
Species Human (GRCh38) Human (GRCh38)
Location 4:163122313-163122335 4:163122340-163122362
Sequence CCAGCTCTAAACAATCAACAAAA CAGAACAAAAAGAAGTGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 1047} {0: 1, 1: 0, 2: 5, 3: 88, 4: 737}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!