ID: 983095146_983095149

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 983095146 983095149
Species Human (GRCh38) Human (GRCh38)
Location 4:163552640-163552662 4:163552659-163552681
Sequence CCCTATAGACACACTCAGGCCTC CCTCGTTGAATCCATCACTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!