ID: 983212984_983213001

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 983212984 983213001
Species Human (GRCh38) Human (GRCh38)
Location 4:164977576-164977598 4:164977619-164977641
Sequence CCACCGAGCCCCCGCGAGGAAGG AAGTGGGCTGCTTCCTGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95} {0: 1, 1: 0, 2: 2, 3: 24, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!