ID: 983241161_983241165

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 983241161 983241165
Species Human (GRCh38) Human (GRCh38)
Location 4:165234823-165234845 4:165234841-165234863
Sequence CCTTTTTTTCTCAATAAAAGTAG AGTAGATAGGAGACTGGGTACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 560} {0: 1, 1: 1, 2: 0, 3: 26, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!