ID: 983241161_983241168

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 983241161 983241168
Species Human (GRCh38) Human (GRCh38)
Location 4:165234823-165234845 4:165234872-165234894
Sequence CCTTTTTTTCTCAATAAAAGTAG GCCTATAATCCCAGTACTTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 560} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!