ID: 983242410_983242413

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 983242410 983242413
Species Human (GRCh38) Human (GRCh38)
Location 4:165248476-165248498 4:165248495-165248517
Sequence CCCAATGAGGAAGGTGAGCAGAC AGACACGTGCTTCCAAGGAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!