ID: 983273166_983273169

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 983273166 983273169
Species Human (GRCh38) Human (GRCh38)
Location 4:165587219-165587241 4:165587242-165587264
Sequence CCAAAAGCCCACTAGTAAAATTA TTACACATTAAACTCTTTAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!