ID: 983369704_983369709

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 983369704 983369709
Species Human (GRCh38) Human (GRCh38)
Location 4:166842813-166842835 4:166842833-166842855
Sequence CCTGCCAGTCCCGCACTGCCGGC GGCCTGCACTCCTCAGCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 286} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!