ID: 983383391_983383393

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 983383391 983383393
Species Human (GRCh38) Human (GRCh38)
Location 4:167025551-167025573 4:167025570-167025592
Sequence CCTCCAGGTCAGGTACTTAGGTC GGTCTGTGAGAACCAAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81} {0: 1, 1: 0, 2: 1, 3: 17, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!