ID: 983509072_983509085

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 983509072 983509085
Species Human (GRCh38) Human (GRCh38)
Location 4:168588160-168588182 4:168588193-168588215
Sequence CCCTTGACCCCATTCCCAGTTTC CACTGTGAGCCCTGGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 26, 4: 322} {0: 1, 1: 0, 2: 4, 3: 50, 4: 472}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!