ID: 983547690_983547704

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 983547690 983547704
Species Human (GRCh38) Human (GRCh38)
Location 4:168979985-168980007 4:168980026-168980048
Sequence CCAGGCAGGGCCCCCCCAGCTTG ATGATTATTCTGATGGACAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 305} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!